SGN Marker TG223

SGN-M89

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
790
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TATTCAAGAAAATATTGTGTAGTGTTCTCCAATATTCAACTATTTAAGTTCAATGGATCTAGACACACAATATTATTAATTCTCGTCGCC
GATGGGATGGTTGAGTGATTGAAGCATAGGAATAACATCCTGGAGATTCTAGGTTTGGACTCCAGTTTGAACATAAGTGTGAGCCCATCT
GCTTTATCTTACAAGTTCAATTCAAACTTGTGTGAGTGGGCCATAGTAGATCCATGCAAAATAGTGGTTATGACGCTATGGTGAGTTCAT
GAGAAGAATTATTGTTCCTTAGGAACAGTGACAGGAAATTCAATGGTCAAATAACATCAAGAAGACTTTTTGGATTAGTTACTGAGTGAT
GTTCAGAAGAGGGACTAAATATCTAACATGCCCCCTCAAGCTCCAGATGGTAAAGCAACTTGAGTTTGAGTTACTAGAATTTAGTAACAT
AAAAAGGTTTTCCAT
Reverse sequence
TTTCCACACACACAAAAAAAACATCTTGAACACACTGTAATCCCCCTCTTCATCAAATTCTCCTGTGTCAACACAACTTCCTTAGCCAGT
AACCACACAACTTCCCTCTTCTGAACATTACAAAGTCGCTGATCCAGAAAGTCTTGTTCTTGATGCTATTTGACCATTGAATTTCCTGTC
ACTATCCAACATGAATAGTGTTTGTAGGGAATAAATTGAAATCAGATTACAAGGATCCAAATATCCATCCCCAACAATGTACTGTTTATG
CCCGAAGGTGAGGATAAAAAGATGGAAAACCTTTTTATGTTACTAAATTCTAGTAACTCAAACTCAAGTTGCTTTACCATCTGGAGCTTG
AGGGGGCATGTTAGATATTTAGTCCCTCTTCTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53222)
Chromosome
6
Position
29.99 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_6 MQTL_1_Maturity_6 MQTL_2_Late_blight_6 MQTL_2_Maturity_6
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39947)
Chromosome
9
Position
32.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8041)
Chromosome
9
Position
33.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8042)
Chromosome
9
Position
28.90 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8046)
Chromosome
6
Position
18.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992
Other PCR data 
PCR data   Exp. ID 35619
Forward primer (5'-3')
CAAGAAAATATTGTGTAGTGTTCTCCA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCCCTCTTCATCAAATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 110
Forward primer (5'-3')
Unknown
Digested band sizes (using unknown)
Solanum pennellii LA716: 700
Solanum lycopersicum LA925: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG223 was used as an overgo probe on plate 15 [well A8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTAATTCTCGTCGCCGATGGGATG
B sequence
GCTTCAATCACTCAACCATCCCAT
AB sequence
TTAATTCTCGTCGCCGATGGGATGGTTGAG
Marker sequence
TATTCAAGAAAATATTGTGTAGTGTTCTCCAATATTCAACTATTTAAGTT
CAATGGATCTAGACACACAATATTATTAATTCTCGTCGCCGATGGGATGG
TTGAGTGATTGAAGCATAGGAATAACATCCTGGAGATTCTAGGTTTGGAC
TCCAGTTTGAACATAAGTGTGAGCCCATCTGCTTTATCTTACAAGTTCAA
TTCAAACTTGTGTGAGTGGGCCATAGTAGATCCATGCAAAATAGTGGTTA
TGACGCTATGGTGAGTTCATGAGAAGAATTATTGTTCCTTAGGAACAGTG
ACAGGAAATTCAATGGTCAAATAACATCAAGAAGACTTTTTGGATTAGTT
ACTGAGTGATGTTCAGAAGAGGGACTAAATATCTAACATGCCCCCTCAAG
CTCCAGATGGTAAAGCAACTTGAGTTTGAGTTACTAGAATTTAGTAACAT
AAAAAGGTTTTCCAT
Genomic location of TG223  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D89 marker 89
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)