SGN Marker SSR218

SGN-M891

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 55 High: 50
Repeat motif: TCA   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: GTGGTTATCCCAAGACCCAA
Reverse primer: CGCCAGTCTTCCTCTGACTT
Predicted size: 127
Derivations 
This marker was derived from EST read SGN-E82815
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53492)
Chromosome
10
Position
24.13 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39190)
Chromosome
10
Position
33.70 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 126
Forward primer (5'-3')
GTGGTTATCCCAAGACCCAA
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CGCCAGTCTTCCTCTGACTT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 127+143
Solanum lycopersicum LA925: 127+127
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR218 was used as an overgo probe on plate 6 [well A2]

Plausible BAC Matches:   P077B13,   P334G02,   P020D06,   P095C09,   P120F17,   P318A13,   P116A01,   P165G16,   P131F22,   P331J04,   P261N09,   P123P03,   P044D09,   P281O18,   P037N23,   P333B22,   P162B22,   P296F18,   P103C04

 Overgo Sequences

A sequence
ACTCCGTTCACAAGTCAGAGGAAG
B sequence
AGAATTGCACGCCAGTCTTCCTCT
AB sequence
ACTCCGTTCACAAGTCAGAGGAAGACTGGC
Marker sequence
AAAAGGTTGATAGCATTTGTGGTTATCCCAAGACCCAATTCAGGTTTTCA
TCATCATCATCATCATCAAGTCAGAGAGGGTTCAGAGGTGGGGTTGTTGC
TATGGCTGCACCAGACTCCGTTCACAAGTCAGAGGAAGACTGGCGTGCAA
TTCTATCTTCTGAGCAGTTCCGTATTCTAAGACAGAAAGGCACTGAGTGT
CCATGTACCGGAGAGTATGACAAGTTTTCTGGTGAAGGAGTCTACCAATG
TGCAGGATGTAGCAC
Genomic location of SSR218  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D891 marker 891
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)