SGN Marker C2_At5g40530

SGN-M8913
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302774 (SGN)
125202 (CGN)
---
Capsicum annuumMultipleSGN-U202778---
Lycopersicon CombinedSingleSGN-U221235---
Solanum tuberosumSingleSGN-U251361---
ArabidopsisSingleAt5g40530 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49299)
Chromosome
2
Position
48.85 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47239)
Chromosome
2
Position
154.13 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41531)
Chromosome
2
Position
135.50 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43507
Forward primer (5'-3')
ACATGATCCTTCAGTCATTGCTTGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTTGGATAATCGGTTCCCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38853)
Chromosome
2
Position
139.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39962
Forward primer (5'-3')
ACATGATCCTTCAGTCATTGCTTGTG
Accessions and product sizes
Solanum pennellii TA56
300
Solanum lycopersicum TA209
300
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTTGGATAATCGGTTCCCATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
100+130
Solanum lycopersicum TA209
100+170
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27378)
Chromosome
5
Position
16.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11883
Forward primer (5'-3')
ACATGATCCTTCAGTCATTGCTTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTGGATAATCGGTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11884
Forward primer (5'-3')
ACATGATCCTTCAGTCATTGCTTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTGGATAATCGGTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11885
Forward primer (5'-3')
ACATGATCCTTCAGTCATTGCTTGTG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTGGATAATCGGTTCCCATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11886
Forward primer (5'-3')
ACATGATCCTTCAGTCATTGCTTGTG
Digested band sizes (using DraI)
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 100+120
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTGGATAATCGGTTCCCATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g40530  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8913 marker 8913
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)