Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker C2_At5g41040

SGN-M8920
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307859 (SGN)
131545 (CGN)
---
Solanum tuberosumSingleSGN-U262675---
ArabidopsisSingleAt5g41040 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41532)
Chromosome
3
Position
95.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43508
Forward primer (5'-3')
AGAAGGGGCTGTCTTTGTTGAGGC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
TCGCGCTTTCCAGACGAAAGCTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38856)
Chromosome
3
Position
75.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39964
Forward primer (5'-3')
AGAAGGGGCTGTCTTTGTTGAGGC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
TCGCGCTTTCCAGACGAAAGCTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
750
Solanum lycopersicum TA209
600
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27385)
Chromosome
5
Position
16.45 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11887
Forward primer (5'-3')
AGAAGGGGCTGTCTTTGTTGAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCGCTTTCCAGACGAAAGCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11888
Forward primer (5'-3')
AGAAGGGGCTGTCTTTGTTGAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCGCTTTCCAGACGAAAGCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11889
Forward primer (5'-3')
AGAAGGGGCTGTCTTTGTTGAGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCGCTTTCCAGACGAAAGCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11890
Forward primer (5'-3')
AGAAGGGGCTGTCTTTGTTGAGGC
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCGCGCTTTCCAGACGAAAGCTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,EcoRV,HinfI,TaqI
All possible enzymes for lycopersicum and pimpinellifolium: Hpy188I
  
Accessions and product sizes
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 43822
Forward primer (5'-3')
AGAAGGGGCTGTCTTTGTTGAGGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GATAATGACACACATGATATAAAGACACAG
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g41040F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g41040  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8920 marker 8920
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)