SGN Marker C2_At5g41270

SGN-M8922
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302094 (SGN)
120861 (CGN)
---
Lycopersicon CombinedSingleSGN-U237348---
Solanum tuberosumSingleSGN-U246658---
ArabidopsisSingleAt5g41270 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42254)
Chromosome
8
Position
110.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38857)
Chromosome
4
Position
0.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 41800
Forward primer (5'-3')
TACCTTCACTTGCTGCGTTTTTTGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTCATATAGCCTCTTGGGGTTCCTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27387)
Chromosome
5
Position
16.53 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 43823
Forward primer (5'-3')
CTCATGGAATTGTCAGTGTGCTCTCC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCCTTTCTTTTGTTCTTCTCAATCC
Enzymes
  
Accessions and product sizes
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g41270  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8922 marker 8922
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)