SGN Marker SSR223

SGN-M896

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 50
Repeat motif: TCT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: TGGCTGCCTCTTCTCTGTTT
Reverse primer: TTTCTTGAAGGGTCTTTCCC
Predicted size: 191
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43786)
Chromosome
10
Position
89.90 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44791
Forward primer (5'-3')
TGGCTGCCTCTTCTCTGTTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTCTTGAAGGGTCTTTCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43246)
Chromosome
10
Position
78.60 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44605
Forward primer (5'-3')
TGGCTGCCTCTTCTCTGTTT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTTCTTGAAGGGTCTTTCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40782)
Chromosome
10
Position
79.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39193)
Chromosome
10
Position
75.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14148
Forward primer (5'-3')
TGGCTGCCTCTTCTCTGTTT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTTCTTGAAGGGTCTTTCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 191+198
Solanum lycopersicum LA925: 191
Approximate temperature
55°C
  
PCR data   Exp. ID 133
Forward primer (5'-3')
TGGCTGCCTCTTCTCTGTTT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TTTCTTGAAGGGTCTTTCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 191+193
Solanum pennellii LA716: 191+190
Approximate temperature
55°C
  
Genomic location of SSR223  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D896 marker 896
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)