SGN Marker C2_At5g47390

SGN-M8980
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300514 (SGN)
123537 (CGN)
---
Lycopersicon CombinedSingleSGN-U215724---
Solanum tuberosumSingleSGN-U246633---
ArabidopsisSingleAt5g47390 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38875)
Chromosome
8
Position
56.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39977
Forward primer (5'-3')
TGGTGGCTCTGTTGATGGTTATGC
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
ACATCCTATGCTCCTCCTCAGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27447)
Chromosome
5
Position
19.25 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11940
Forward primer (5'-3')
TGGTGGCTCTGTTGATGGTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCTATGCTCCTCCTCAGTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11941
Forward primer (5'-3')
TGGTGGCTCTGTTGATGGTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCTATGCTCCTCCTCAGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 11942
Forward primer (5'-3')
TGGTGGCTCTGTTGATGGTTATGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCTATGCTCCTCCTCAGTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 11943
Forward primer (5'-3')
TGGTGGCTCTGTTGATGGTTATGC
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1150
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCTATGCTCCTCCTCAGTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1150
Solanum pennellii LA716: 1100
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4 (2), plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g47390  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D8980 marker 8980
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)