SGN Marker C2_At5g49880

SGN-M9019
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307713 (SGN)
129770 (CGN)
---
Lycopersicon CombinedSingleSGN-U224664---
Solanum tuberosumSingleSGN-U257675---
ArabidopsisSingleAt5g49880 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38881)
Chromosome
1
Position
127.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39983
Forward primer (5'-3')
TCGGCTCCGTTGCCGGAATC
Accessions and product sizes
Solanum lycopersicum TA209
1000
Approximate temperature
53°C
Reverse primer (5'-3')
ACTGCTTAAGGCATCAAAAAACTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27487)
Chromosome
5
Position
20.30 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11970
Forward primer (5'-3')
TCGGCTCCGTTGCCGGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTTAAGGCATCAAAAAACTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11971
Forward primer (5'-3')
TCGGCTCCGTTGCCGGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTTAAGGCATCAAAAAACTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 11972
Forward primer (5'-3')
TCGGCTCCGTTGCCGGAATC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTTAAGGCATCAAAAAACTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 32584
Forward primer (5'-3')
TCGGCTCCGTTGCCGGAATC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACTGCTTAAGGCATCAAAAAACTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: HincII, RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g49880F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g49880  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9019 marker 9019
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)