SGN Marker C2_At5g49970

SGN-M9022
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308750 (SGN)
127500 (CGN)
---
Lycopersicon CombinedMultipleSGN-U218657---
Solanum tuberosumSingleSGN-U255980---
ArabidopsisSingleAt5g49970 on TAIR---
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42260)
Chromosome
3
Position
113.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43829
Forward primer (5'-3')
AGGTAGATTTTAGTAGGGGAAATCC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41540)
Chromosome
3
Position
114.40 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43516
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38882)
Chromosome
3
Position
99.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39984
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
Accessions and product sizes
Solanum pennellii TA56
100
Solanum lycopersicum TA209
100
Approximate temperature
55°C
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27490)
Chromosome
5
Position
20.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11975
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 580+750
Approximate temperature
55°C
  
PCR data   Exp. ID 11976
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 580+750
Approximate temperature
55°C
  
PCR data   Exp. ID 11977
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 580+750
Approximate temperature
55°C
  
PCR data   Exp. ID 13880
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 400+700
Approximate temperature
55°C
  
PCR data   Exp. ID 13881
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 680
Approximate temperature
55°C
  
PCR data   Exp. ID 13882
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13883
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 400+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13884
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13885
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400+650
Approximate temperature
55°C
  
PCR data   Exp. ID 13886
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400+650
Approximate temperature
55°C
  
PCR data   Exp. ID 13887
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 750+920
Approximate temperature
55°C
  
PCR data   Exp. ID 13888
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 150+700
Approximate temperature
55°C
  
PCR data   Exp. ID 13889
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 150+700
Approximate temperature
55°C
  
PCR data   Exp. ID 13890
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 32659
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 480+700
Approximate temperature
55°C
  
PCR data   Exp. ID 33271
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 480+700
Approximate temperature
55°C
  
PCR data   Exp. ID 33272
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 480+700
Approximate temperature
55°C
  
PCR data   Exp. ID 33273
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 400+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33274
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 33275
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 400+650
Approximate temperature
55°C
  
PCR data   Exp. ID 33276
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 400+650
Approximate temperature
55°C
  
PCR data   Exp. ID 11978
Forward primer (5'-3')
AATTGGCAGGCTTGAGTGTTGC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 510+640
Solanum lycopersicum LA925: 410+510
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCATTGTTACCAGGACCAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, TaqI, HinfI, DpanII
  
Accessions and product sizes
Solanum lycopersicum LA925: 580+750
Solanum pennellii LA716: 580+750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g49970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9022 marker 9022
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)