SGN Marker C2_At5g51840

SGN-M9047
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303389 (SGN)
122372 (CGN)
---
Capsicum annuumSingleSGN-U199579---
Lycopersicon CombinedMultipleSGN-U218639---
Solanum tuberosumSingleSGN-U252616---
ArabidopsisSingleAt5g51840 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38887)
Chromosome
11
Position
103.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39989
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
Accessions and product sizes
Solanum pennellii TA56
250
Solanum lycopersicum TA209
250
Approximate temperature
55°C
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
100
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27517)
Chromosome
5
Position
21.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11998
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11999
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12000
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13922
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13923
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13924
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13925
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13926
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13927
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13928
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13929
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13930
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13931
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13932
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33293
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33294
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33295
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33296
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 12001
Forward primer (5'-3')
TGGCAAACCTGTCAATGGAGATG
Digested band sizes (using AluI)
Solanum pennellii LA716: 190
Solanum lycopersicum LA925: 210
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTGTTCTTCCTTCTGCTTAGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g51840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9047 marker 9047
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)