SGN Marker C2_At5g53000

SGN-M9058
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308839 (SGN)
128801 (CGN)
---
Capsicum annuumSingleSGN-U197703---
Lycopersicon CombinedSingleSGN-U240700---
Solanum tuberosumSingleSGN-U262643---
ArabidopsisSingleAt5g53000 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46777)
Chromosome
12
Position
79.90 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38890)
Chromosome
1
Position
8.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39992
Forward primer (5'-3')
TTGCTTGAAATGCTGAAGAAAGAGG
Accessions and product sizes
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
1000
Approximate temperature
55°C
Reverse primer (5'-3')
AAGTAGCACAGGTGATAGGTGCTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
650
Solanum pennellii TA56
800
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27529)
Chromosome
5
Position
21.50 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12010
Forward primer (5'-3')
TTGCTTGAAATGCTGAAGAAAGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AAGTAGCACAGGTGATAGGTGCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12011
Forward primer (5'-3')
TTGCTTGAAATGCTGAAGAAAGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AAGTAGCACAGGTGATAGGTGCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12012
Forward primer (5'-3')
TTGCTTGAAATGCTGAAGAAAGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGTAGCACAGGTGATAGGTGCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 32585
Forward primer (5'-3')
TTGCTTGAAATGCTGAAGAAAGAGG
 
 
Mg+2 concentration
3mM
Reverse primer (5'-3')
AAGTAGCACAGGTGATAGGTGCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 12013
Forward primer (5'-3')
TTGCTTGAAATGCTGAAGAAAGAGG
Digested band sizes (using TaqI)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 400
Mg+2 concentration
3mM
Reverse primer (5'-3')
AAGTAGCACAGGTGATAGGTGCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,BsiHKAI,DpnII,TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 500
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g53000F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, PDF chromatogram
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g53000  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9058 marker 9058
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)