SGN Marker C2_At5g54160

SGN-M9074
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303228 (SGN)
123802 (CGN)
---
Capsicum annuumMultipleSGN-U196747---
Lycopersicon CombinedSingleSGN-U216168---
ArabidopsisSingleAt5g54160 on TAIR---
Mapped locations  
Map: Arabidopsis COSII   
Map version
44 (location: 27545)
Chromosome
5
Position
22.00 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII

PCR data   Exp. ID 41865
Forward primer (5'-3')
TTCCGTTGCCCCACTTTTGC
Accessions and product sizes
Solanum lycopersicum TA209
1150
Solanum pennellii TA56
1100
Approximate temperature
55°C
Reverse primer (5'-3')
TTGAATGGGATTCCACCATCAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1150
Solanum pennellii TA56
1100
Mg+2 concentration
1.5mM
   Enzymes
  
Other PCR data 
PCR data   Exp. ID 12017
Forward primer (5'-3')
TTCCGTTGCCCCACTTTTGC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TTGAATGGGATTCCACCATCAAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2500
Approximate temperature
Unknown
  
PCR data   Exp. ID 12331
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12332
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12333
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12334
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12335
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12336
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12337
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12338
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 12339
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 33364
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 700+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33365
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700+1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33366
Forward primer (5'-3')
TGGAACTTATGGCTAAGGCTGGTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTACAGTAGCCCCTGTTCCA
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: Multiple
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g54160  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9074 marker 9074
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)