SGN Marker C2_At5g57655

SGN-M9104
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300975 (SGN)
122340 (CGN)
---
Capsicum annuumMultipleSGN-U198857---
Lycopersicon CombinedMultipleSGN-U214763---
Solanum tuberosumSingleSGN-U246743---
ArabidopsisSingleAt5g57655 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38895)
Chromosome
7
Position
0.10 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39997
Forward primer (5'-3')
AACACCAGTATGACTGGGATGCTGC
Accessions and product sizes
Solanum lycopersicum TA209
1500
Solanum pennellii TA56
1500
Approximate temperature
55°C
Reverse primer (5'-3')
ACATCCATCAAAAATTGATCTGTGTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250+350+400+500
Solanum pennellii TA56
350+1150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27577)
Chromosome
5
Position
23.37 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12035
Forward primer (5'-3')
AACACCAGTATGACTGGGATGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCATCAAAAATTGATCTGTGTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 520
Approximate temperature
55°C
  
PCR data   Exp. ID 12036
Forward primer (5'-3')
AACACCAGTATGACTGGGATGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCATCAAAAATTGATCTGTGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 520
Approximate temperature
55°C
  
PCR data   Exp. ID 12037
Forward primer (5'-3')
AACACCAGTATGACTGGGATGCTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCATCAAAAATTGATCTGTGTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 520
Approximate temperature
55°C
  
PCR data   Exp. ID 12038
Forward primer (5'-3')
AACACCAGTATGACTGGGATGCTGC
Digested band sizes (using TaqI)
Solanum pennellii LA716: 120+350
Solanum lycopersicum LA925: 150+350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATCCATCAAAAATTGATCTGTGTCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: ApoI,BstBI
All possible enzymes for lycopersicum and pimpinellifolium: BsaAI/BstBAI,HpyCH4IV/MaeII/TaiI/TscI
  
Accessions and product sizes
Solanum lycopersicum LA925: 520
Solanum pennellii LA716: 520
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g57655F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g57655  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9104 marker 9104
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)