SGN Marker C2_At5g57970

SGN-M9110
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309601 (SGN)
129144 (CGN)
---
Lycopersicon CombinedSingleSGN-U235991---
ArabidopsisSingleAt5g57970 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132195)
Chromosome
12
Position
39.35 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49305)
Chromosome
12
Position
3.20 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47245)
Chromosome
12
Position
43.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42264)
Chromosome
12
Position
32.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43833
Forward primer (5'-3')
TCAAAGAAAAGATGTGCCTGGGTG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGCCCCGCAAAGGACAAGGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41543)
Chromosome
9
Position
121.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43519
Forward primer (5'-3')
TCAAAGAAAAGATGTGCCTGGGTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCCCGCAAAGGACAAGGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38896)
Chromosome
12
Position
43.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39998
Forward primer (5'-3')
TCAAAGAAAAGATGTGCCTGGGTG
Accessions and product sizes
Solanum pennellii TA56
425
Solanum lycopersicum TA209
450
Approximate temperature
55°C
Reverse primer (5'-3')
TGCCCCGCAAAGGACAAGGAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
350
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27583)
Chromosome
5
Position
23.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g57970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9110 marker 9110
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)