SGN Marker C2_At5g58410

SGN-M9121
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306641 (SGN)
126525 (CGN)
---
Lycopersicon CombinedSingleSGN-U225805---
Solanum tuberosumSingleSGN-U247819---
ArabidopsisSingleAt5g58410 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46782)
Chromosome
7
Position
56.30 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42265)
Chromosome
9
Position
48.30 cM
Confidence
F(LOD3)
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43834
Forward primer (5'-3')
TCTTACCCTCTGCGACCTGTGGATG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TTTGCAGGTTTTGCAAGCTAGCCGCCG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41544)
Chromosome
9
Position
43.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43520
Forward primer (5'-3')
TCTTACCCTCTGCGACCTGTGGATG
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
TGACACAATGGACAAGTTGACTTGTGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38900)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40002
Forward primer (5'-3')
TCTTACCCTCTGCGACCTGTGGATG
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
900
Approximate temperature
55°C
Reverse primer (5'-3')
TGACACAATGGACAAGTTGACTTGTGAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900
Solanum pennellii TA56
525
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27594)
Chromosome
5
Position
23.63 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Universal primers for Asterid species 
No additional PCR data found.
Genomic location of C2_At5g58410  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9121 marker 9121
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)