SGN Marker C2_At5g60540

SGN-M9137
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301938 (SGN)
122058 (CGN)
---
Lycopersicon CombinedSingleSGN-U219471---
Solanum tuberosumMultipleSGN-U250971---
ArabidopsisSingleAt5g60540 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41546)
Chromosome
11
Position
106.20 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43522
Forward primer (5'-3')
TGCTGTTTTCATCCGTGCTCC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
AGTTAATTCGGGATGAAAAGCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38904)
Chromosome
11
Position
76.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40006
Forward primer (5'-3')
TGCTGTTTTCATCCGTGCTCC
Accessions and product sizes
Solanum lycopersicum TA209
200
Solanum pennellii TA56
200
Approximate temperature
55°C
Reverse primer (5'-3')
AGTTAATTCGGGATGAAAAGCAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27612)
Chromosome
5
Position
24.35 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12059
Forward primer (5'-3')
TGCTGTTTTCATCCGTGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTAATTCGGGATGAAAAGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12060
Forward primer (5'-3')
TGCTGTTTTCATCCGTGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTAATTCGGGATGAAAAGCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12061
Forward primer (5'-3')
TGCTGTTTTCATCCGTGCTCC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTTAATTCGGGATGAAAAGCAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g60540  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9137 marker 9137
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)