SGN Marker SSR241

SGN-M914

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 52.381
Repeat motif: AAT   Repeat number: 13
Repeat motif:    Repeat number:
Forward primer: TCAACAGCATAGTGGAGGAGG
Reverse primer: TCCTCGGTAATTGATCCACC
Predicted size: 200
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53493)
Chromosome
7
Position
13.99 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39196)
Chromosome
7
Position
0.00 cM
Confidence
F(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 86
Forward primer (5'-3')
TCAACAGCATAGTGGAGGAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCGGTAATTGATCCACC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 200+200
Solanum pennellii LA716: 185+200
Approximate temperature
55°C
  
Genomic location of SSR241  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D914 marker 914
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)