SGN Marker C2_At5g61510

SGN-M9149
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304920 (SGN)
123490 (CGN)
---
Capsicum annuumSingleSGN-U198722---
Lycopersicon CombinedSingleSGN-U239064---
Solanum tuberosumSingleSGN-U265629---
ArabidopsisSingleAt5g61510 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38908)
Chromosome
6
Position
6.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40010
Forward primer (5'-3')
AGTTCCTACTGCGCCGCTGCTTC
Accessions and product sizes
Solanum lycopersicum TA209
3000
Approximate temperature
Unknown
Reverse primer (5'-3')
AGCATGAACAAGTACTGTGTGCCCACG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27625)
Chromosome
5
Position
24.76 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12075
Forward primer (5'-3')
AGTTCCTACTGCGCCGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATGAACAAGTACTGTGTGCCCACG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 12076
Forward primer (5'-3')
AGTTCCTACTGCGCCGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATGAACAAGTACTGTGTGCCCACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 12077
Forward primer (5'-3')
AGTTCCTACTGCGCCGCTGCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATGAACAAGTACTGTGTGCCCACG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 12078
Forward primer (5'-3')
AGTTCCTACTGCGCCGCTGCTTC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 1600
Solanum pennellii LA716: 500+1000
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCATGAACAAGTACTGTGTGCCCACG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI, TaqI, HinfI, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 1600
Solanum lycopersicum LA925: 1600
Approximate temperature
55°C
  
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g61510  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9149 marker 9149
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)