SGN Marker C2_At5g62440

SGN-M9158
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302540 (SGN)
121988 (CGN)
---
Capsicum annuumSingleSGN-U201613---
Solanum tuberosumSingleSGN-U250940---
ArabidopsisSingleAt5g62440 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38911)
Chromosome
3
Position
120.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40013
Forward primer (5'-3')
AGTTTCGTTTCCTCCGTGGAGATG
Accessions and product sizes
Solanum pennellii TA56
150
Solanum lycopersicum TA209
150
Approximate temperature
55°C
Reverse primer (5'-3')
TCCTTTCTGATTCTGAATGACCCTTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
130
Solanum pennellii TA56
150
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27635)
Chromosome
5
Position
25.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12086
Forward primer (5'-3')
AGTTTCGTTTCCTCCGTGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCTGATTCTGAATGACCCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12087
Forward primer (5'-3')
AGTTTCGTTTCCTCCGTGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCTGATTCTGAATGACCCTTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12088
Forward primer (5'-3')
AGTTTCGTTTCCTCCGTGGAGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCTGATTCTGAATGACCCTTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 950
Approximate temperature
55°C
  
PCR data   Exp. ID 12089
Forward primer (5'-3')
AGTTTCGTTTCCTCCGTGGAGATG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 570
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTTTCTGATTCTGAATGACCCTTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, RsaI, DraI, TaqI, DpnII
  
Accessions and product sizes
Solanum lycopersicum LA925: 950
Solanum pennellii LA716: 950
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120061 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120061 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120101 plant #1, plain text
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var septentrionale 120103 plant #3, plain text
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120044 plant #1, plain text
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense var quitoense 120052 plant #3, plain text
Forward amplicon sequence for S. hirtum 120060 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120060 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #1, plain text
Forward amplicon sequence for S. hirtum 120071 plant #2, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120071 plant #2, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g62440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9158 marker 9158
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)