SGN Marker C2_At5g63840

SGN-M9184
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304031 (SGN)
120405 (CGN)
---
Lycopersicon CombinedSingleSGN-U217186---
Solanum tuberosumSingleSGN-U250415---
ArabidopsisSingleAt5g63840 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38916)
Chromosome
4
Position
56.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40018
Forward primer (5'-3')
TCCTTCTTTTCAAAGGGCTGGAAC
Accessions and product sizes
Solanum pennellii TA56
900
Solanum lycopersicum TA209
900
Approximate temperature
53°C
Reverse primer (5'-3')
TGCTTTAGCTCCAGGGGACAATCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900
Solanum pennellii TA56
400+500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27660)
Chromosome
5
Position
25.56 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12105
Forward primer (5'-3')
TCCTTCTTTTCAAAGGGCTGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTTAGCTCCAGGGGACAATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12106
Forward primer (5'-3')
TCCTTCTTTTCAAAGGGCTGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTTAGCTCCAGGGGACAATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12107
Forward primer (5'-3')
TCCTTCTTTTCAAAGGGCTGGAAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCTTTAGCTCCAGGGGACAATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 700
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g63840F.cds.txt, plain text
Amplicon sequence alignment, FASTA
At5g63840R.cds.txt, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, PDF chromatogram
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, PDF chromatogram
Forward amplicon sequence for S. pennellii TA56, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text

Genomic location of C2_At5g63840  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9184 marker 9184
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)