SGN Marker TG66

SGN-M92

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2700
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG66 image not available
Forward sequence
CACGTATATCAAACACATATCAATGCAGTTATTTTTTGTATTAAATATTTTAATTTTGAATTTTTTATATGAGAAAACTTTTGGTAATGT
GTTTTTTTCGAAATTGTCATGCACCACACAAATTCAGATGAATTTTTCCATAATGAACCAGCAACCACGTAGAGTTTCAACACGTATATC
AGACGTAGAGTTTCAACATGTAAATCAGACGTAGAGTTTTAACACGTATATCTAAACTAACAAAACTATTCTTTTTCAATCAACCATCTT
GATTTCATGAAAAATTTCAAGATAATATATGTTTTTTTCTAACCCATGTAAATTTAATTTAATGAAATTTCAATATCATATACACGAACA
AAGAACGAAAAAGGAAAAAGGAAAAAAAGCAAGAAAGTAAATACTAATACAGCACAACGCAAAAGACTCTGCCTATAGAAATCAAATTAA
TATTGTGTAGGGGTTGGGTTTAAGCTACAACTTTGAAGG
Reverse sequence
TAAATATTCTGGTTTTCACAGTTTACTATCCACTTCTACCCTTAGTAGGTTCATTCTATATTCACAAGCTTATGTGCTTGATCTATCTAT
CCTTTCAAATCAATTTCTGATGTCAAACACAAATAATATACATTCTTGATGCATCAAACGTCATTAATCAGTTCGATTTTCTAAGTCAAG
ATTATTCATCAATTCTATTTAGGTAACAAGTATAATGAATTTGATAAATATCTTGCATATTATACCTAGAATTTGCTGAGGTGTAAGCCT
CTGGGAAGGATCCGTACATAACATTCCTTTAATCAACTCTTTTGCTGAAGATGATATTGTATCCCAGCGATCAGACGGAAACCGCAAATC
CGCTGCCCTGACAGCATCAAAGATCTTTGACTTTGTCTTCCCCCAAAATGGTGGTATTCCACTAAGAAGAATGTAAAGAATAACACCAGT
GCTCCAGATATCAGCTGCTTCATTATAACCTCCTGCCAGGACCTCAGGAGCTAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1700841e-149266 (52.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53581)
Chromosome
3
Position
25.01 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53375)
Chromosome
3
Position
46.48 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8055)
Chromosome
3
Position
50.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8057)
Chromosome
3
Position
14.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8056)
Chromosome
3
Position
28.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG66 was used as an overgo probe on plate 4 [well H8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P134G19,   P199I02,   P213C20,   P020K22,   P045C02,   P118N03,   P107L11,   P046E05,   P110I06,   P234I04,   P212G17,   P212I17,   P238K17

 Overgo Sequences

A sequence
GCAACCACGTAGAGTTTCAACACG
B sequence
CTCTACGTCTGATATACGTGTTGA
AB sequence
GCAACCACGTAGAGTTTCAACACGTATATC
Marker sequence
CACGTATATCAAACACATATCAATGCAGTTATTTTTTGTATTAAATATTT
TAATTTTGAATTTTTTATATGAGAAAACTTTTGGTAATGTGTTTTTTTCG
AAATTGTCATGCACCACACAAATTCAGATGAATTTTTCCATAATGAACCA
GCAACCACGTAGAGTTTCAACACGTATATCAGACGTAGAGTTTCAACATG
TAAATCAGACGTAGAGTTTTAACACGTATATCTAAACTAACAAAACTATT
CTTTTTCAATCAACCATCTTGATTTCATGAAAAATTTCAAGATAATATAT
GTTTTTTTCTAACCCATGTAAATTTAATTTAATGAAATTTCAATATCATA
TACACGAACAAAGAACGAAAAAGGAAAAAGGAAAAAAAGCAAGAAAGTAA
ATACTAATACAGCACAACGCAAAAGACTCTGCCTATAGAAATCAAATTAA
TATTGTGTAGGGGTTGGGTTTAAGCTACAACTTTGAAGG
Genomic location of TG66  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D92 marker 92
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)