SGN Marker C2_At5g64670

SGN-M9200
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201958---
Lycopersicon CombinedSingleSGN-U225643---
Solanum tuberosumSingleSGN-U254361---
ArabidopsisSingleAt5g64670 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49308)
Chromosome
2
Position
39.90 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47248)
Chromosome
2
Position
85.53 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38919)
Chromosome
2
Position
76.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40021
Forward primer (5'-3')
TGATAAATGCTGGGAAGATTGACTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATCAACCTGGCTCCATCTTCTATTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27676)
Chromosome
5
Position
25.87 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12122
Forward primer (5'-3')
TGATAAATGCTGGGAAGATTGACTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAACCTGGCTCCATCTTCTATTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 12123
Forward primer (5'-3')
TGATAAATGCTGGGAAGATTGACTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAACCTGGCTCCATCTTCTATTTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12124
Forward primer (5'-3')
TGATAAATGCTGGGAAGATTGACTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAACCTGGCTCCATCTTCTATTTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 220
Approximate temperature
55°C
  
PCR data   Exp. ID 12125
Forward primer (5'-3')
TGATAAATGCTGGGAAGATTGACTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 220
Solanum pennellii LA716: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCAACCTGGCTCCATCTTCTATTTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 220
Solanum pennellii LA716: 200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g64670  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9200 marker 9200
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)