SGN Marker C2_At5g64730

SGN-M9201
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302258 (SGN)
119964 (CGN)
---
Capsicum annuumSingleSGN-U203186---
Lycopersicon CombinedSingleSGN-U220125---
Solanum tuberosumSingleSGN-U267659---
ArabidopsisSingleAt5g64730 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46788)
Chromosome
5
Position
70.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42270)
Chromosome
11
Position
46.10 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43839
Forward primer (5'-3')
TGAAGTCCGCGATGTCCATGTCAC
Accessions and product sizes
Approximate temperature
63°C
Reverse primer (5'-3')
ACATGAACAAAGTTTTGAATTGTCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41550)
Chromosome
12
Position
45.60 cM
Confidence
I
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43526
Forward primer (5'-3')
GATCGACAAGTATTTTATTGGGATGT
Accessions and product sizes
Approximate temperature
60°C
Reverse primer (5'-3')
GTAGTCGTCGTTGATTGAGGCATAAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38920)
Chromosome
11
Position
0.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40022
Forward primer (5'-3')
TGAAGTCCGCGATGTCCATGTCAC
Accessions and product sizes
Solanum pennellii TA56
1600
Solanum lycopersicum TA209
1600
Approximate temperature
55°C
Reverse primer (5'-3')
ACATGAACAAAGTTTTGAATTGTCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1600
Solanum pennellii TA56
500+1000
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27677)
Chromosome
5
Position
25.89 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12126
Forward primer (5'-3')
TGAAGTCCGCGATGTCCATGTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGAACAAAGTTTTGAATTGTCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2400
Approximate temperature
55°C
  
PCR data   Exp. ID 12127
Forward primer (5'-3')
TGAAGTCCGCGATGTCCATGTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGAACAAAGTTTTGAATTGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2400
Approximate temperature
55°C
  
PCR data   Exp. ID 12128
Forward primer (5'-3')
TGAAGTCCGCGATGTCCATGTCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACATGAACAAAGTTTTGAATTGTCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At5g64730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9201 marker 9201
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)