SGN Marker SSR248

SGN-M921

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 47.619 High: 50
Repeat motif: TA   Repeat number: 21
Repeat motif:    Repeat number:
Forward primer: GCATTCGCTGTAGCTCGTTT
Reverse primer: GGGAGCTTCATCATAGTAACG
Predicted size: 249
Derivations 
This marker was derived from EST read SGN-E142359
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49366)
Chromosome
10
Position
52.29 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47301)
Chromosome
10
Position
30.76 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39198)
Chromosome
10
Position
35.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 130
Forward primer (5'-3')
GCATTCGCTGTAGCTCGTTT
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGGAGCTTCATCATAGTAACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 251+251
Solanum pennellii LA716: 221+251
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
SSR248 was used as an overgo probe on plate 1 [well H3]

Plausible BAC Matches:   P322I21,   P255P03,   P074M01,   P247J01,   P150P13,   P033C24,   P310K19,   P206B22,   P294M03,   P315E21,   P212C02,   P053C17,   P094C13,   P229E06,   P141I23,   P045P14,   P008L22,   P094L13,   P022F15,   P101M13,   P282B09

 Non-Plausible BAC matches

P048O11,   P163E14,   P175M04,   P318K13,   P250K18

 Overgo Sequences

A sequence
GAACATTCGGAGATCCACCATCAC
B sequence
TCCTCTGCTGCTCTTTGTGATGGT
AB sequence
GAACATTCGGAGATCCACCATCACAAAGAG
Marker sequence
GAAAGGGATGCACCTCCACATATCATCAACACATGCAACGGAAGACATTG
TGGAGATACATTCACAGGTCCCAACGGTCCTAACAAACCTTCTCTATGGA
CTGAAAATTGGACCGCTCAGTACAGAACATTCGGAGATCCACCATCACAA
AGAGCAGCAGAGGATATTGCATTCGCTGTAGCTCGTTTCTTTGCAAAGAA
TGGAACTCTTACAAACTATTACATGGTATATATATATATATATATATATA
TATATATATATATATATATTGATGTAATCTGCTTATTTTCTCGTAAACCT
TAATTTAATCATATCTAAATTAATCATACAATCTATGTTATACAGTACTA
TGGTGGAACCAACTATGGAAGGACAGGCTCATCATTCGTGACAACTCGTT
ACTATGATGAAGCTCCCCTTGATGAGTTCGGTTTGTATAGGGAACCAAAA
TGGAGTCATTTGAGGGATTTACACAGGGCTTTGAGGCTATCC
Genomic location of SSR248  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D921 marker 921
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)