SGN Marker C2_At5g66090

SGN-M9218
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304094 (SGN)
122861 (CGN)
---
Lycopersicon CombinedSingleSGN-U217612---
Solanum tuberosumSingleSGN-U247467---
ArabidopsisSingleAt5g66090 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109250)
Chromosome
2
Position
70.12 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Pepper-COSII   
Map version
58 (location: 41551)
Chromosome
2
Position
93.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43527
Forward primer (5'-3')
ATCTCTCTGAGGGTTCAAGACAGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TATATCAGCTCCATACTTCTTTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38921)
Chromosome
2
Position
83.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40023
Forward primer (5'-3')
ATCTCTCTGAGGGTTCAAGACAGG
Accessions and product sizes
Solanum lycopersicum TA209
950
Solanum pennellii TA56
950
Approximate temperature
55°C
Reverse primer (5'-3')
TATATCAGCTCCATACTTCTTTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
700
Solanum pennellii TA56
570
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27694)
Chromosome
5
Position
26.44 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12129
Forward primer (5'-3')
ATCTCTCTGAGGGTTCAAGACAGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TATATCAGCTCCATACTTCTTTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
Unknown
  
PCR data   Exp. ID 12130
Forward primer (5'-3')
ATCTCTCTGAGGGTTCAAGACAGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TATATCAGCTCCATACTTCTTTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
Unknown
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Genomic location of C2_At5g66090  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9218 marker 9218
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)