SGN Marker C2_At5g67370

SGN-M9238
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U201896---
Lycopersicon CombinedSingleSGN-U217640---
Solanum tuberosumMultipleSGN-U265683---
ArabidopsisSingleAt5g67370 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46789)
Chromosome
2
Position
7.30 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46540)
Chromosome
2
Position
66.50 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. acuminata

Map: Eggplant-COSII   
Map version
63 (location: 42271)
Chromosome
2
Position
89.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Eggplant-COSII

PCR data   Exp. ID 43840
Forward primer (5'-3')
TGAAACCAGTCATTAAAATGCTGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTACTGTCCACCGGCCAATGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-COSII   
Map version
58 (location: 41552)
Chromosome
2
Position
112.40 cM
Confidence
F(LOD3)
Protocol
dCAPS


Pepper-COSII

PCR data   Exp. ID 43528
Forward primer (5'-3')
TGAAACCAGTCATTAAAATGCTGAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AACAGTTCTTCTTTCCTTTGATTGTC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38923)
Chromosome
2
Position
129.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 40025
Forward primer (5'-3')
TGAAACCAGTCATTAAAATGCTGAAG
Accessions and product sizes
Solanum lycopersicum TA209
450
Solanum pennellii TA56
450
Approximate temperature
55°C
Reverse primer (5'-3')
AGTACTGTCCACCGGCCAATGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
450
Solanum pennellii TA56
410
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27714)
Chromosome
5
Position
26.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12138
Forward primer (5'-3')
TGAAACCAGTCATTAAAATGCTGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACTGTCCACCGGCCAATGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12139
Forward primer (5'-3')
TGAAACCAGTCATTAAAATGCTGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACTGTCCACCGGCCAATGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12140
Forward primer (5'-3')
TGAAACCAGTCATTAAAATGCTGAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACTGTCCACCGGCCAATGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 12141
Forward primer (5'-3')
TGAAACCAGTCATTAAAATGCTGAAG
Digested band sizes (using TaqI)
Solanum pennellii LA716: 150+250
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGTACTGTCCACCGGCCAATGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Amplicon sequence alignment, FASTA
At5g67370F.cds.txt, plain text
Forward amplicon sequence for S. pimpinellifolium LA1589, AB1 chromatogram - [View]
Forward amplicon sequence for S. pimpinellifolium LA1589, plain text
Forward amplicon sequence for S. lycopersicum TA209, AB1 chromatogram - [View]
Forward amplicon sequence for S. lycopersicum TA209, plain text
Forward amplicon sequence for S. pennellii TA56, AB1 chromatogram - [View]
Forward amplicon sequence for S. pennellii TA56, plain text

Genomic location of C2_At5g67370  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9238 marker 9238
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)