SGN Marker TG68

SGN-M94

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
GGATTTTGATGAACTTGTATCTGTGCTTCTAGCTCCACCTAGGATGAGTTTGGATTTGTACGATTAACAAATGTTTGAGCTGAAAGAATT
AAATTTGATTACACCTGCCTTTACATATTTTTGTTGCGTAAGGATTTTCTATGAAGAATATATATGTATGTATGTGTAAAGGATGCACTA
AGCATCTCGCATTTTGATAAAGAAATGAACTTTGGGCTTAACTCAACTCCAAAAGTTAGCTCATGAAGTGAGGATATCGCGTAAGACCGT
ATAAGGAGACCTAGAACCCATCCCACAACAATGTGTGACTCCAACACATTCACGCAAGTTCTGGGGAAGGGTTGCACTCGTAAGGGTTGT
GATGTAGGCAGCCATAATTGTGTGTACCCATTCGTTAGAAAACTACACTGTGCAAGTGGAGTTAAATTGTATCTTTTTTGGTTTTGTGTG
AGTTGTTCAATCCCCTTGACATGAAAAAAAGAAGCAAAATTCAAGTATAATGGTAAAAGGGGATTCAAAAT
Reverse sequence
TTGGGTCAGCCATAGTACTTCGTGATATATCTCTGACAGAAGATATCTGCTCAAGACCATGAACAATACGGAGACATAAGAAGGAAAGAA
GTTCAGTGCAGCACAAAATTTTAATAAGTTAACTTAAAGGGGGATAAGAGGCAAAACCAATATAAAAGTTTGGACAGACAAATTTTAATT
AGTATCAAAGAGTGAATGATGCTAAAAGAAGAGATGCTTAAATATCTGATACTATAAAGTAAGCCATGACTAATTGGTAATTATGAATGG
CATATGATACGACTATCAGTTTTGACTGTTGTCTACAATAATGATTTCAGAAACATATGATATATTTCAAATAGAATTGAATAACAACAC
TTGTTCAAATACCTAGCTCTCGGAGGCAGATCCAGAATTTTAGAAAGTGGGTGCAGTAAATCACAAGAGTACACCTCTGCTAGAATGGGT
GTGTACTGTAACAAAACCTGTTTTGATATGCATAT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1561673.7e-0540 (7.7% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53861)
Chromosome
12
Position
5.80 cM
Confidence
uncalculated
Protocol
RFLP

Pentanal_content_pna12_1 Fruit_weight_fw12_1 Titratable_acidity_ta12_1 Fruit_diameter_fd12_1 pH_pH12_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53582)
Chromosome
12
Position
2.33 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Tomato-EXPIMP 2009

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53583)
Chromosome
2
Position
1.05 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53376)
Chromosome
12
Position
41.68 cM
Confidence
uncalculated
Protocol
unknown

MQTL_2_Late_blight_12 MQTL_1_Late_blight_12
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43887)
Chromosome
12
Position
5.70 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43627)
Chromosome
12
Position
10.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43351)
Chromosome
12
Position
8.70 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42502)
Chromosome
12
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40824)
Chromosome
12
Position
17.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36569
Forward primer (5'-3')
TGCACTAAGCATCTCGCATT
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TTTCATGTCAAGGGGATTGA
Digested band sizes (using EcoRV)
Solanum lycopersicum TA209
200
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40124)
Chromosome
12
Position
21.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8062)
Chromosome
12
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8061)
Chromosome
12
Position
13.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8060)
Chromosome
12
Position
24.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8066)
Chromosome
12
Position
6.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 14019
Forward primer (5'-3')
TCCACCTAGGATGAGTTTGGA
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 440
Solanum pennellii LA716: 200
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CATGTCAAGGGGATTGAACA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 440
Solanum lycopersicum LA925: 440
Approximate temperature
50°C
  
PCR data   Exp. ID 14019
Forward primer (5'-3')
TCCACCTAGGATGAGTTTGGA
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 440
Solanum pennellii LA716: 200
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CATGTCAAGGGGATTGAACA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 440
Solanum pennellii LA716: 440
Approximate temperature
50°C
  
PCR data   Exp. ID 14153
Forward primer (5'-3')
TCCACCTAGGATGAGTTTGGA
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 440
Solanum pimpinellifolium LA1589: 200
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CATGTCAAGGGGATTGAACA
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 450
Solanum lycopersicum LA925: 450
Approximate temperature
50°C
  
PCR data   Exp. ID 148
Forward primer (5'-3')
Unknown
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 440
Solanum pennellii LA716: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 440
Solanum pennellii LA716: 440
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
TG68 was used as an overgo probe on plate 1 [well C10]

Plausible BAC Matches:   P152M18

 Overgo Sequences

A sequence
ACCCATCCCACAACAATGTGTGAC
B sequence
GCGTGAATGTGTTGGAGTCACACA
AB sequence
ACCCATCCCACAACAATGTGTGACTCCAAC
Marker sequence
GGATTTTGATGAACTTGTATCTGTGCTTCTAGCTCCACCTAGGATGAGTT
TGGATTTGTACGATTAACAAATGTTTGAGCTGAAAGAATTAAATTTGATT
ACACCTGCCTTTACATATTTTTGTTGCGTAAGGATTTTCTATGAAGAATA
TATATGTATGTATGTGTAAAGGATGCACTAAGCATCTCGCATTTTGATAA
AGAAATGAACTTTGGGCTTAACTCAACTCCAAAAGTTAGCTCATGAAGTG
AGGATATCGCGTAAGACCGTATAAGGAGACCTAGAACCCATCCCACAACA
ATGTGTGACTCCAACACATTCACGCAAGTTCTGGGGAAGGGTTGCACTCG
TAAGGGTTGTGATGTAGGCAGCCATAATTGTGTGTACCCATTCGTTAGAA
AACTACACTGTGCAAGTGGAGTTAAATTGTATCTTTTTTGGTTTTGTGTG
AGTTGTTCAATCCCCTTGACATGAAAAAAAGAAGCAAAATTCAAGTATAA
TGGTAAAAGGGGATTCAAAAT
Genomic location of TG68  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D94 marker 94
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)