SGN Marker SSR276

SGN-M949

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 50
Repeat motif: ATG   Repeat number: 7
Repeat motif: ATT   Repeat number: 7
Repeat motif:    Repeat number:
Forward primer: CTCCGGCAAGAGTGAACATT
Reverse primer: CGACGGAGTACTTCGCATTT
Predicted size: 148
Derivations 
This marker was derived from EST read SGN-E41968
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53494)
Chromosome
7
Position
39.36 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43789)
Chromosome
7
Position
35.80 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44797
Forward primer (5'-3')
CTCCGGCAAGAGTGAACATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CGACGGAGTACTTCGCATTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43249)
Chromosome
7
Position
33.00 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44611
Forward primer (5'-3')
CTCCGGCAAGAGTGAACATT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CGACGGAGTACTTCGCATTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40784)
Chromosome
7
Position
37.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39203)
Chromosome
7
Position
18.00 cM
Confidence
I(LOD2)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14123
Forward primer (5'-3')
CTCCGGCAAGAGTGAACATT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGACGGAGTACTTCGCATTT
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 148+177
Solanum lycopersicum LA925: 148+150
Approximate temperature
55°C
  
Genomic location of SSR276  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D949 marker 949
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)