SGN Marker U212745

SGN-M9532

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40197)
Chromosome
4
Position
60.20 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14036
Forward primer (5'-3')
TCGGGCACAATCAATTGCTG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 450
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCATGAAATATGGAGCTTCTGGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 14036
Forward primer (5'-3')
TCGGGCACAATCAATTGCTG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 420
Solanum pennellii LA716: 450
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCATGAAATATGGAGCTTCTGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
Genomic location of U212745  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9532 marker 9532
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)