SGN Marker U214677

SGN-M9535

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40203)
Chromosome
2
Position
126.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14041
Forward primer (5'-3')
TCAACAAGGCTCTGGAAAAGTTGG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 850+950
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATATGGATCCCCTGTGGATGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650+2000
Solanum pennellii LA716: 1650+2000
Approximate temperature
55°C
  
PCR data   Exp. ID 14041
Forward primer (5'-3')
TCAACAAGGCTCTGGAAAAGTTGG
Digested band sizes (using TaqI)
Solanum pennellii LA716: 850+950
Solanum lycopersicum LA925: 1650
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATATGGATCCCCTGTGGATGTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650+2000
Solanum pennellii LA716: 1650+2000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U214677  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9535 marker 9535
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)