SGN Marker U216327

SGN-M9536

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40205)
Chromosome
7
Position
52.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14043
Forward primer (5'-3')
TCACTTCTTGTATTTGTGCAGAGG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 640
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGTGCCCTTATGTTAGCTTTATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 650
Approximate temperature
50°C
  
PCR data   Exp. ID 14043
Forward primer (5'-3')
TCACTTCTTGTATTTGTGCAGAGG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 640
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGTGCCCTTATGTTAGCTTTATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 650
Approximate temperature
50°C
  
Unigene blast matches for primers 
Genomic location of U216327  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9536 marker 9536
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)