SGN Marker U220487

SGN-M9538

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40215)
Chromosome
1
Position
162.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14047
Forward primer (5'-3')
TCTCTAGATATGTCTCCAATGGATGAAGC
Digested band sizes (using DraI)
Solanum pennellii LA716: 290+390
Solanum lycopersicum LA925: 650
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGGCAGGAACTTTTAACAGATCTGCCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 14047
Forward primer (5'-3')
TCTCTAGATATGTCTCCAATGGATGAAGC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 290+390
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGGCAGGAACTTTTAACAGATCTGCCAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U220487  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9538 marker 9538
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)