SGN Marker U220926

SGN-M9539

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40216)
Chromosome
7
Position
63.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14048
Forward primer (5'-3')
TTGGTCTATTTGCAATATTTGATGG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 370
Solanum pennellii LA716: 140+230
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AATCAATATGGCTGTAACAGCAGTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 14048
Forward primer (5'-3')
TTGGTCTATTTGCAATATTTGATGG
Digested band sizes (using AluI)
Solanum pennellii LA716: 140+230
Solanum lycopersicum LA925: 370
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AATCAATATGGCTGTAACAGCAGTTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U220926  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9539 marker 9539
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)