SGN Marker U221113

SGN-M9540

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40217)
Chromosome
1
Position
32.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14049
Forward primer (5'-3')
TCGCCGATAATCTCCTCAAACAG
Digested band sizes (using HinfI)
Solanum pennellii LA716: 420
Solanum lycopersicum LA925: 450
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATTCTTCTCTCCACGATAAATGTTAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 14049
Forward primer (5'-3')
TCGCCGATAATCTCCTCAAACAG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 420
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATTCTTCTCTCCACGATAAATGTTAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
Genomic location of U221113  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9540 marker 9540
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)