Sol Genomics Network

SGN-M9541

Synonyms

None

Locus associations

None

Map: Tomato - Kazusa and SolCAP markers mapped to genome
Map version 105 (location: 51057)
Chromosome 5
Position 61.67 MB
Confidence uncalculated
Protocol unknown

Tomato - Kazusa and SolCAP markers mapped to genome

Kazusa F2-2000 genetic map

Pepper-COSII

PCR data Exp. ID 43596

Forward primer (5'-3')

AAGCCTCCTTGACAAATGCATATAG

Accessions and product sizes

Approximate temperature

55°C

Reverse primer (5'-3')

AGATATAGCTACAGTGGCAGCTTCATC

Digested band sizes (using unknown enzyme)

Mg⁺² concentration

Unknown

Enzymes

Tomato-EXPEN 2000

Other PCR data

PCR data Exp. ID 14050
Forward primer (5'-3') AAGCCTCCTTGACAAATGCATATAG	Digested band sizes (using HincI) Solanum pennellii LA716: 620 Solanum lycopersicum LA925: 520	Mg⁺² concentration Unknown
Reverse primer (5'-3') AGATATAGCTACAGTGGCAGCTTCATC	Enzymes
Accessions and product sizes Solanum lycopersicum LA925: 1000 Solanum pennellii LA716: 1000	Approximate temperature 55°C

PCR data Exp. ID 35642
Forward primer (5'-3') AAGCCTCCTTGACAAATGCATATAG	Digested band sizes (using HincII) Solanum pennellii LA716: 620 Solanum lycopersicum LA925: 520	Mg⁺² concentration 1.5mM
Reverse primer (5'-3') AGATATAGCTACAGTGGCAGCTTCATC	Enzymes
Accessions and product sizes Solanum pennellii LA716: 1000 Solanum lycopersicum LA925: 1000	Approximate temperature 55°C

Unigene blast matches for primers

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9541 marker 9541

User comments

Please wait, checking for comments. (If comments do not show up, access them here)

Accessions	Seedlots
Accessions		Breeding Program	Seedlot Name	Contents	Seedlot Location	Count	Weight(g)

SGN is supported by , and hosted at
Cite SGN using | Disclaimer