SGN Marker U221402

SGN-M9541

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51057)
Chromosome
5
Position
61.67 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48993)
Chromosome
5
Position
94.17 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41640)
Chromosome
5
Position
72.10 cM
Confidence
F(LOD3)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43596
Forward primer (5'-3')
AAGCCTCCTTGACAAATGCATATAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGATATAGCTACAGTGGCAGCTTCATC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40218)
Chromosome
5
Position
81.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14050
Forward primer (5'-3')
AAGCCTCCTTGACAAATGCATATAG
Digested band sizes (using HincI)
Solanum lycopersicum LA925: 520
Solanum pennellii LA716: 620
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGATATAGCTACAGTGGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 35642
Forward primer (5'-3')
AAGCCTCCTTGACAAATGCATATAG
Digested band sizes (using HincII)
Solanum lycopersicum LA925: 520
Solanum pennellii LA716: 620
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGATATAGCTACAGTGGCAGCTTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U221402  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9541 marker 9541
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)