SGN Marker U221455

SGN-M9542

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46793)
Chromosome
10
Position
35.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40219)
Chromosome
10
Position
81.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14051
Forward primer (5'-3')
AGGCGCTTCTTATTATCTTTCTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACCACAAGCAATCATTTCTACACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 870
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 14051
Forward primer (5'-3')
AGGCGCTTCTTATTATCTTTCTC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ACCACAAGCAATCATTTCTACACC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 870
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U221455  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9542 marker 9542
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)