SGN Marker U228448

SGN-M9544

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40233)
Chromosome
9
Position
59.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14053
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 1100
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1650
Solanum pennellii LA716: 1650
Approximate temperature
55°C
  
PCR data   Exp. ID 14053
Forward primer (5'-3')
TGAACCCACTCCCACTGCTGAGTC
Digested band sizes (using DraI)
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1650
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCTGTGTCGAATAGCACAAGAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1650
Solanum lycopersicum LA925: 1650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U228448  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9544 marker 9544
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)