SGN Marker U231369

SGN-M9546

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40239)
Chromosome
6
Position
12.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14056
Forward primer (5'-3')
AGGGACTAAAACTTGGTGTCTATTCTG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 160
Solanum pennellii LA716: 200
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCGAACCTGGCCGAACTTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 14056
Forward primer (5'-3')
AGGGACTAAAACTTGGTGTCTATTCTG
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 160
Solanum pennellii LA716: 200
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCGAACCTGGCCGAACTTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U231369  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9546 marker 9546
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)