SGN Marker U233884

SGN-M9547

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40241)
Chromosome
7
Position
0.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14057
Forward primer (5'-3')
ACTTGGGTTGTTCCTCGCTTTGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCAAGGCTAATAACTTTGACTCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 450
Solanum pennellii LA716: 430
Approximate temperature
53°C
  
PCR data   Exp. ID 14057
Forward primer (5'-3')
ACTTGGGTTGTTCCTCGCTTTGG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AGCAAGGCTAATAACTTTGACTCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 430
Solanum lycopersicum LA925: 450
Approximate temperature
53°C
  
Unigene blast matches for primers 
Genomic location of U233884  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9547 marker 9547
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)