SGN Marker U234506

SGN-M9548

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40243)
Chromosome
4
Position
16.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14059
Forward primer (5'-3')
ACCCTTCATGATGCGTGTGATAGAC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 380
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCTGCAAACTCAATTAATTTCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 580
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 14059
Forward primer (5'-3')
ACCCTTCATGATGCGTGTGATAGAC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 380
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCTGCAAACTCAATTAATTTCTGCTTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 580
Solanum lycopersicum LA925: 580
Approximate temperature
55°C
  
Unigene blast matches for primers 
Genomic location of U234506  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9548 marker 9548
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)