SGN Marker U230982

SGN-M9552

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U230982
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40237)
Chromosome
1
Position
4.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35651
Forward primer (5'-3')
TCTGAAAGCCCCTTGTTATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CATTGACAGGAGCTGGAAGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
Genomic location of U230982  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9552 marker 9552
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)