SGN Marker U242666

SGN-M9577

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U242666
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51061)
Chromosome
2
Position
36.11 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48997)
Chromosome
2
Position
56.52 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40249)
Chromosome
2
Position
49.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35656
Forward primer (5'-3')
ACCCACTTCGATTCATGCTG
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 125
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GGTTGAAAATGGGTCACTGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Genomic location of U242666  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9577 marker 9577
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)