SGN Marker U223436

SGN-M9578

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U223436
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51058)
Chromosome
2
Position
35.37 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48994)
Chromosome
2
Position
52.50 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41641)
Chromosome
2
Position
67.20 cM
Confidence
I(LOD2)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43597
Forward primer (5'-3')
TGTTGCATCTTTGCTTTTGG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
CACCATGAATGGCAGCTATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40227)
Chromosome
2
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35648
Forward primer (5'-3')
TGTTGCATCTTTGCTTTTGG
Digested band sizes (using HaeIII)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 300+600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CACCATGAATGGCAGCTATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 900
Solanum pennellii LA716: 900
Approximate temperature
53°C
  
Genomic location of U223436  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9578 marker 9578
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)