SGN Marker SSR285

SGN-M958

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 45 High: 60
Repeat motif: AAT   Repeat number: 13
Repeat motif:    Repeat number:
Forward primer: AGTGGCTCTCACCTACTGCG
Reverse primer: CAATTCTCAGGCATGAAACG
Predicted size: 276
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39205)
Chromosome
7
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14122
Forward primer (5'-3')
AGTGGCTCTCACCTACTGCG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAATTCTCAGGCATGAAACG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 158+276
Solanum lycopersicum LA925: 158+276
Approximate temperature
55°C
  
PCR data   Exp. ID 87
Forward primer (5'-3')
AGTGGCTCTCACCTACTGCG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAATTCTCAGGCATGAAACG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 276+276
Solanum pennellii LA716: 265+276
Approximate temperature
55°C
  
Genomic location of SSR285  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D958 marker 958
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)