SGN Marker fw2.2

SGN-M9583

SynonymsNone
Locus associations  
This marker is associated with the fruit weight 2.2 locus.

Mapped locations  
Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40903)
Chromosome
2
Position
94.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40539)
Chromosome
2
Position
117.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14072
Forward primer (5'-3')
GCGAGAGCGAGTTGAGTGTATATC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 490+810
Solanum pennellii LA716: 1300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAGAAGAGAGAAGCTGCAAAGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
50°C
  
PCR data   Exp. ID 14072
Forward primer (5'-3')
GCGAGAGCGAGTTGAGTGTATATC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 490+810
Solanum pennellii LA716: 1300
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAGAAGAGAGAAGCTGCAAAGCAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
50°C
  
Genomic location of fw2.2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9583 marker 9583
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)