SGN Marker ORFX-2

SGN-M9585

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39124)
Chromosome
2
Position
117.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35584
Forward primer (5'-3')
CGGTGGTCTGGACAAAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACTTTATTTTAGAAAACGAAGCAAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
Genomic location of ORFX-2  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9585 marker 9585
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)