SGN Marker SSR286

SGN-M959

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 50 High: 48
Repeat motif: CAG   Repeat number: 8
Repeat motif:    Repeat number:
Forward primer: AGCTATGGAGTTTCAGGACCA
Reverse primer: ATTCAGGTAGCATGGAACGC
Predicted size: 107
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43790)
Chromosome
7
Position
12.30 cM
Confidence
uncalculated
Protocol
SSR


Sun1642 x LA1589

PCR data   Exp. ID 44798
Forward primer (5'-3')
AGCTATGGAGTTTCAGGACCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCAGGTAGCATGGAACGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43250)
Chromosome
7
Position
12.20 cM
Confidence
uncalculated
Protocol
SSR


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

PCR data   Exp. ID 44612
Forward primer (5'-3')
AGCTATGGAGTTTCAGGACCA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ATTCAGGTAGCATGGAACGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40785)
Chromosome
7
Position
12.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008
Other PCR data 
PCR data   Exp. ID 31680
Forward primer (5'-3')
AGCTATGGAGTTTCAGGACCA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
ATTCAGGTAGCATGGAACGC
Enzymes
  
Accessions and product sizes
Approximate temperature
48°C
  
Genomic location of SSR286  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D959 marker 959
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)