SGN Marker TG221

SGN-M96

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
890
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG221 image not available
Forward sequence
ATAGGGAATTGGACACTCCAAACTGCTAATAATTTCATGTTGACTAAGGAGCGTGGGATAGCAGTATGCTTCACCGAATGGGAGACATAA
CTCAGTAAATTGAAGTTGATACAAGATTTATGATGTTGATTTGTTGGCCATTAGTTTATCTGTTGGGGGAAATAAACCTAACATATGAAT
TACGAAGCGTTTTCTCTAGTGCACAGTTGCTTGGTGTTGATTATAGGTTGGTTGGTTGGTTGAACTACAGTTGCGTTGTTGGGAGTAAAT
TCTAGATATTGTGGAATCTCTTTTAAAAACTTTTTACTCCTAATCTCAATTTCTGGACATGAGACTAACAATCGTCTTTGTTCTCTAGTG
TTGTGATAAACTTAAAAATATGTTGTATGCGCATGAAGAGTAAAAGTAGTTAACAGAGAAGTGAAAAGGAAGGAAGCAAAGTAGAAAACT
TGGAATGAAGAGGCTCTCAAATTAGATTTCG
Reverse sequence
TGTGATGATTGTGAAGCGCCCAAAGATCAAGGCTTGAGATTTGGTTGATGCTGTGTATTTATATAATTCCAATAATAAATAGAGTAGATT
TGGAAATTGGAGTAGCTAGCAATTTTCACAAGTCTACGCACAAAATTTGTAACAAAACATAATAGCTTGGGGCCGTCTCAAAAGAAAATT
AGTAAATCAGAAACAAAAAGCTCCTATCAGTAGTTTTATTTGTTGATTTTTTTTAGCGGATGGATGGATGGATCATATCCATCTTTGTCC
TTGTCCTAAGCCAAATAGAAAAACCTTTCAAAGAAACAAAATTACTTTGCGAAATTGATGATTCAATAACAATTGGAGTACTAGTATATT
TCAATGTTTAAAAATGCAGATTAGTAGTGTTATTTTTAAGGGATTTCGAGAATATGTTATTGGCCTCGAAATCTAATTTGAGAGCCTCTT
CATTCCAAGTTTTCTACTTTGCTTCCTTCCTTTTCACTTCTCTGTTAACT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1597813.8e-51101 (21.0% of RFLP seq)+
SGN-U1481462.6e-1854 (10.8% of RFLP seq)-
SGN-U1481459e-154321 (64.2% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39946)
Chromosome
6
Position
101.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8073)
Chromosome
6
Position
99.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG221 was used as an overgo probe on plate 2 [well B11]

Plausible BAC Matches:   P112J14,   P213P13

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGTTGACTAAGGAGCGTGGGATAG
B sequence
TCGGTGAAGCATACTGCTATCCCA
AB sequence
TGTTGACTAAGGAGCGTGGGATAGCAGTAT
Marker sequence
ATAGGGAATTGGACACTCCAAACTGCTAATAATTTCATGTTGACTAAGGA
GCGTGGGATAGCAGTATGCTTCACCGAATGGGAGACATAACTCAGTAAAT
TGAAGTTGATACAAGATTTATGATGTTGATTTGTTGGCCATTAGTTTATC
TGTTGGGGGAAATAAACCTAACATATGAATTACGAAGCGTTTTCTCTAGT
GCACAGTTGCTTGGTGTTGATTATAGGTTGGTTGGTTGGTTGAACTACAG
TTGCGTTGTTGGGAGTAAATTCTAGATATTGTGGAATCTCTTTTAAAAAC
TTTTTACTCCTAATCTCAATTTCTGGACATGAGACTAACAATCGTCTTTG
TTCTCTAGTGTTGTGATAAACTTAAAAATATGTTGTATGCGCATGAAGAG
TAAAAGTAGTTAACAGAGAAGTGAAAAGGAAGGAAGCAAAGTAGAAAACT
TGGAATGAAGAGGCTCTCAAATTAGATTTCG
Genomic location of TG221  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D96 marker 96
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)