SGN Marker SSR287

SGN-M960

SynonymsNone
Locus associationsNone
SSR info 

Annealing temperatures: Low: 41 High: 45
Repeat motif: TA   Repeat number: 12
Repeat motif:    Repeat number:
Forward primer: GCATCCCAAACAATCCAATC
Reverse primer: TCCACTTTCAAGATCAGAGCAA
Predicted size: 168
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39206)
Chromosome
2
Position
107.00 cM
Confidence
I
Protocol
SSR


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 31902
Forward primer (5'-3')
GCATCCCAAACAATCCAATC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TCCACTTTCAAGATCAGAGCAA
Enzymes
  
Accessions and product sizes
Approximate temperature
45°C
  
Genomic location of SSR287  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D960 marker 960
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)