SGN Marker U227536

SGN-M9610

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U227536
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109262)
Chromosome
5
Position
66.78 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40231)
Chromosome
5
Position
15.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35649
Forward primer (5'-3')
CTGAATGCTCTGTGCTCGAC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 1200
Solanum pennellii LA716: 1300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCTCATCTCTGGGGTTCAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Genomic location of U227536  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D9610 marker 9610
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)